Product Data Sheet
Bepirovirsen sodium
Catalog No. A50901
Bepirovirsen sodium is an antisense oligonucleotide designed to specifically target and inhibit all HBV messenger RNAs. This compound effectively reduces HBV-derived RNAs, viral DNA, and associated proteins, making it a valuable tool in the research of chronic HBV infection. The binding site sequence for Bepirovirsen sodium is GCACTTCGCTTCACCTCTGC, underscoring its specificity and utility in virology studies.
Chemical Information
| Catalog Num | A50901 |
|---|---|
| M. Wt | 7344 (free acid) |
| Formula | C230H290N88Na19O115P19S19 |
| Purity | >98% |
| Storage | at -20 °C 3 years (powder form); at -20 °C 6 months (Solution base) |
| CAS No. | 2563929-84-8 |
| Synonyms | ISIS 505358 sodium |
| SMILES | [Bepirovirsen (sodium)] |
Biological Activity
| Description | Bepirovirsen sodium is an antisense oligonucleotide designed to specifically target and inhibit all HBV messenger RNAs. This compound effectively reduces HBV-derived RNAs, viral DNA, and associated proteins, making it a valuable tool in the research of chronic HBV infection. The binding site sequence for Bepirovirsen sodium is GCACTTCGCTTCACCTCTGC, underscoring its specificity and utility in virology studies. |
|---|
RETURN POLICY
Adooq’s Unconditional Return Policy ensures a smooth online shopping experience for our customers. If you are in any way unsatisfied with your purchase, you may return any item(s) within 7 days of receiving it. In the event of product quality issues, either protocol related or product related problems, you may return any item(s) within 365 days from the original purchase date. Please follow the instructions below when returning products.
Adooq’s Unconditional Return Policy ensures a smooth online shopping experience for our customers. If you are in any way unsatisfied with your purchase, you may return any item(s) within 7 days of receiving it. In the event of product quality issues, either protocol related or product related problems, you may return any item(s) within 365 days from the original purchase date. Please follow the instructions below when returning products.
SHIPPING AND STORAGE
Adooq products are transported at room temperature. If you receive the product at room temperature, please rest assured, the Adooq Quality Inspection Department has conducted experiments to verify that the normal temperature placement of one month will not affect the biological activity of powder products. After collecting, please store the product according to the requirements described in the datasheet. Most Adooq products are stable under the recommended conditions.
Adooq products are transported at room temperature. If you receive the product at room temperature, please rest assured, the Adooq Quality Inspection Department has conducted experiments to verify that the normal temperature placement of one month will not affect the biological activity of powder products. After collecting, please store the product according to the requirements described in the datasheet. Most Adooq products are stable under the recommended conditions.
