Bepirovirsen sodium is an antisense oligonucleotide designed to specifically target and inhibit all HBV messenger RNAs. This compound effectively reduces HBV-derived RNAs, viral DNA, and associated proteins, making it a valuable tool in the research of chronic HBV infection. The binding site sequence for Bepirovirsen sodium is GCACTTCGCTTCACCTCTGC, underscoring its specificity and utility in virology studies.
Bepirovirsen sodium is an antisense oligonucleotide designed to specifically target and inhibit all HBV messenger RNAs. This compound effectively reduces HBV-derived RNAs, viral DNA, and associated proteins, making it a valuable tool in the research of chronic HBV infection. The binding site sequence for Bepirovirsen sodium is GCACTTCGCTTCACCTCTGC, underscoring its specificity and utility in virology studies.
This calculator helps you calculate mass of compound based on solution concentration, volume and molecular weight in a specific solution using the formula:
