HBV

Items 1-50 of 140

Page
per page
Set Descending Direction
Catalog No.
Product Name
Application
Product Information
Citations
  1. Squalamine(MSI-1256) is an aminosterol compound with potent broad spectrum antiviral activity.
  2. HBV inhibitor

    1793065-08-3 (R-isomer) 2093044-32-5 (S-isomer) 1092970-12-1 (racemic) 1646361-04-7 (mesylate)
  3. antiviral

    BAY41-4109 racemic is a mixture of R-isomer of BAY41-4109 and S-isomer of BAY41-4109. It inhibits hepatitis B virus (HBV) replication in HepG2.2.15 cells without affecting cell growth with IC50 value of 202nM .
  4. RRM2 targeting compound

    Osalmid is a ribonucleotide reductase small subunit M2 (RRM2) targeting compound; suppresses ribonucleotide reductase activity with an IC50 of 8.23 μM.
  5. Oxethazaine is a topical anesthetic, in preventing acid-induced esophageal pain.
  6. anti-HBV agent

    Bifendate is an anti-HBV agent, attenuating hepatic steatosis in cholesterol/bile salt- and high-fat diet-induced hypercholesterolemia in mice.
  7. Clevudine is an antiviral drug for the treatment of hepatitis B.
  8. HBV inhibitor

    Entecavir (SQ 34676; BMS 200475) is a potent and selective inhibitor of HBV, with an EC50 of 3.75 nM in HepG2 cell.
  9. hepatoprotective agent

    Bicyclol, also known as SY 801, is a hepatoprotective agent. Bicyclol upregulates transcription factor Nrf2, HO-1 expression and protects rat brains against focal ischemia.
  10. Cetylpyridinium chloride is a cationic quaternary ammonium compound used as oropharyngeal antiseptic.
  11. antiviral agent

    Besifovir (LB80331), a parent drug converted by LB80380, further metabolizes to its active form, LB80317. LB80380 is potent antiviral agent against hepatitis B virus (HBV) .
  12. Helioxanthin 8-1 is an analogue of helioxanthin, exhibites significant in vitro anti-HBV/HCV/HSV-1/HIV activity with EC50 of >5/10/1.4/15 uM.
  13. Helioxanthin derivative 5-4-2 is an analogue of helioxanthin, exhibites significant in vitro anti-HBV activity with EC50 of 0.08 uM in HepG2.2.15 cells.
  14. against HBV activity

    Lagociclovir(MIV-210) is a prodrug of 3'-fluoro-2',3'-dideoxyguanosine with high oral bioavailability in humans and potent activity against HBV.
  15. IMPDH inhibitor

    Merimepodib is a noncompetitive and oral inhibitor of inosine monophosphate dehydrogenase (IMPDH) with broad spectrum antiviral activities.
  16. RIG-1 modulator 1 is an anti-viral compound which can be useful for the treatment of viral infections including influenza virus, HBV, HCV and HIV extracted from patent WO 2015172099 A1.
  17. HBV capsid assembly modulator

    JNJ-632 is a hepatitis B virus (HBV) capsid assembly modulator (CAM).
  18. HBV capsid assembly inhibitor

    AB-423 is an inhibitor of HBV capsid assembly, and potent inhibits HBV replication with EC50/EC90 of 0.08-0.27 μM/0.33-1.32 μM in cells.
  19. HBV inhibitor

    BAY 41-4109 is a potent inhibitor of human hepatitis B virus (HBV) with an IC50 of 53 nM.
  20. HBV modulator

    BA-53038B is a HBV core protein allosteric modulator (CpAM), binding to the HAP pocket and modulating HBV capsid assembly in a distinct manner, with an EC50 value of 3.32 μM.
  21. HBV capsid assembly modulator

    GLP-26 is a HBV capsid assembly modulators (CAM), inhibits HBV DNA replication in Hep AD38 system (IC50=3 nM), and reduces cccDNA by >90% at 1 μM. GLP-26 disrupts the encapsidation of pre-genomic RNA, causes nucleocapsid disassembly and reduces cccDNA pools.
  22. innate immunity agonist

    Inarigivir soproxil is an agonist of innate immunity and shows potent antiviral activity against resistant hepatitis C virus (HCV) variants, with EC50s of 2.2 and 1.0 μM for HCV 1a/1b in cells of genotype 1 HCV replicon systems.
  23. Inarigivir (ORI-9020;SB-9000) is a dinucleotide which can significantly reduce liver HBV DNA in transgenic mice expressing hepatitis B virus.
  24. micronutrient

    Thiamine hydrochloride (Thiamine chloride hydrochloride) is an essential micronutrient needed as a cofactor for many central metabolic enzymes.
  25. Antiviral agent

    Famciclovir(BRL 42810) is a guanine analogue antiviral drug used for the treatment of various herpesvirus infections.
  26. HBV Inhibitor

    Bersacapavir is an HBV capsid assembly modulator that targets hepatitis B virus (HBV) replication. It exhibits a dual mechanism of action by forming complete genome-free empty capsids and inhibiting the de novo synthesis of covalently closed circular DNA (cccDNA). This compound is valuable for research applications focusing on HBV infection and the development of antiviral therapies.
  27. HBV RNase H Inhibitor

    β-Thujaplicinol is a potent inhibitor of hepatitis B virus (HBV) ribonuclease H, showing inhibitory effects on HBV genotypes D and H with IC50 values of 5.9 and 2.3 μM, respectively. Its primary mechanism involves disrupting the enzymatic activity of HBV RNase H, making it a valuable tool for researching HBV replication and pathogenesis. This compound is suitable for studies focused on antiviral development and the therapeutic targeting of HBV.
  28. HBV inhibitor

    ALG-000184 is an orally bioavailable inhibitor targeting hepatitis B virus (HBV). It functions as a prodrug to ALG-001075 and effectively reduces HBV DNA production in liver cells. This compound is intended for research applications in chronic hepatitis B studies, facilitating investigations into therapeutic strategies against HBV infection.

  29. HBV Replication Inhibitor

    AT-130 is a phenylpropenamide derivative that serves as a potent non-nucleoside inhibitor of hepatitis B virus (HBV) replication. It effectively inhibits viral DNA synthesis, exhibiting an EC50 of 0.13 μM against both wild-type and mutant strains of HBV. AT-130 demonstrates significant anti-HBV activity in hepatoma cell lines, making it a valuable tool for research focused on HBV infection and treatment strategies.
  30. HBV Inhibitor

    HBV-IN-4 is a phthalazinone derivative that functions as a potent inhibitor of HBV DNA replication, exhibiting an IC50 value of 14 nM. This compound effectively induces the formation of genome-free capsids, demonstrating substantial anti-HBV activity. Its applications include research into therapeutic strategies for hepatitis B virus infections.
  31. HBV Inhibitor

    Alisol F 24-acetate is a triterpenoid compound that targets Hepatitis B Virus (HBV) by inhibiting the secretion of HBV surface antigens HBsAg and HBeAg, with respective IC50 values of 7.7 µM and 5.1 µM. This compound also exhibits proapoptotic activity, making it a valuable agent for cancer research applications. Its role in regulating viral antigen secretion positions it as a potential therapeutic candidate in HBV-related studies.
  32. HBV Inhibitor

    HBV-IN-23 is a potent inhibitor of Hepatitis B virus (HBV) DNA replication with an IC50 of 0.58 μM. This compound effectively inhibits HBV replication across both sensitive and resistant strains. Additionally, HBV-IN-23 demonstrates anti-hepatocellular carcinoma activity by inducing apoptosis in HepG2 cells, making it a valuable tool for research into HBV and related hepatic conditions.
  33. HBV inhibitor

    Bay 41-4109 less active enantiomer shows less activity than Bay 41-4109. BAY 41-4109 is a potent inhibitor of human hepatitis B virus (HBV) with an IC50 of 53 nM.
  34. HBV inhibitor

    RG7834 (RO 7020322) is a highly selective and orally bioavailable HBV inhibitor, potently inhibits HBV antigens (both HBsAg and HBeAg) and HBV DNA, with IC50s of 2.8, 2.6, and 3.2 nM, respectively, in dHepaRG Cells.
  35. CYP3A4 inducer

    RO6889678 is an inhibitor of HBV with a complex ADME profile. RO6889678 showed an intracellular enrichment of 78-fold in hepatocytes, with an apparent intrinsic clearance of 5.2 ?l/min per mg protein and uptake and biliary clearances of 2.6 and 1.6 ?l/min per mg protein, respectively.
  36. Tenofovir exalidex, also known as HDP-Tenofovir and CMX-157, is a novel lipid acyclic nucleoside phosphonate that delivers high intracellular concentrations of the active antiviral agent tenofovir.
  37. SIRT Inhibitor

    Nicotinamide is a form of vitamin B3 or niacin. Nicotinamide Hydrochloride inhibits SIRT2 activity (IC50: 2 μM). Nicotinamide also inhibits SIRT1. Nicotinamide increases cellular NAD+, ATP, ROS levels. Nicotinamide inhibits tumor growth and improves survival. Nicotinamide also has anti-HBV activity.
  38. HBV Inhibitor

    Isoscopoletin, also known as 6-Hydroxy-7-methoxycoumarin, primarily inhibits hepatitis B virus (HBV) replication. It demonstrates significant cytotoxic effects against human CCRF-CEM leukaemia cells and their multidrug-resistant subline, with IC50 values of 4.0 μM and 1.6 μM, respectively. Additionally, Isoscopoletin exhibits anti-inflammatory properties by modulating the MAPK/NF-κB/STAT/AKT signaling pathways, making it a valuable compound for research in virology and cancer biology.
  39. HBV Inhibitor

    HBV-IN-48 is a potent inhibitor of Hepatitis B Virus (HBV) with demonstrated antiviral activity. It effectively reduces viral replication in HepDE19 cells, achieving an EC50 value of 0.005 μM. Additionally, HBV-IN-48 has shown the ability to lower serum HBV DNA levels in mouse models, making it a valuable tool for studying HBV infections and potential therapeutic interventions.
  40. HBV DNA Synthesis Inhibitor

    LB80317 is an active metabolite of LB80380 that functions as a potent inhibitor of HBV DNA synthesis, exhibiting an EC50 of 0.5 μM. This compound demonstrates antiviral activity, making it a promising candidate for the treatment of chronic hepatitis B. Its ability to inhibit viral replication supports its potential utility in HBV research and therapeutic applications.
  41. HBV Inhibitor

    HBV-IN-21 is a potent inhibitor of hepatitis B virus (HBV) DNA replication, exhibiting an IC50 of 2.2 µM. This compound demonstrates a strong interaction with the HBV core capsid protein, characterized by a dissociation constant (KD) of 60.0 μM. HBV-IN-21 is suited for research applications focused on antiviral drug development and elucidation of HBV replication mechanisms.
  42. HBV Inhibitor

    HBV-IN-22 is a potent inhibitor of Hepatitis B Virus (HBV) DNA replication, demonstrating IC50 values of 0.71 μM against wild-type strains and 0.84 μM against resistant strains. This compound is valuable for research focused on antiviral drug development and understanding HBV resistance mechanisms, making it a critical tool in the study of Hepatitis B therapeutics.
  43. HIV/HBV Inhibitor

    L-2'-Fd4C is an L-nucleoside analogue that acts as an inhibitor of both human immunodeficiency virus (HIV) and hepatitis B virus (HBV). This compound exhibits potent antiviral activity, making it valuable for research focused on the treatment and understanding of these viral infections. Its unique mechanism of action may provide insights into the development of novel therapeutic strategies against HIV and HBV.
  44. HBV Inhibitor

    HBV-IN-53 is an inhibitor of Hepatitis B virus (HBV) that effectively reduces serum levels of HBV DNA. Its potent antiviral activity makes it a valuable tool for research in HBV therapeutics. Additionally, HBV-IN-53 has been shown to exhibit an additive inhibitory effect when combined with Tenofovir disoproxil fumarate, highlighting its potential for use in combination therapy studies.
  45. Anti-HBV Agent

    Bepirovirsen sodium is an antisense oligonucleotide designed to specifically target and inhibit all HBV messenger RNAs. This compound effectively reduces HBV-derived RNAs, viral DNA, and associated proteins, making it a valuable tool in the research of chronic HBV infection. The binding site sequence for Bepirovirsen sodium is GCACTTCGCTTCACCTCTGC, underscoring its specificity and utility in virology studies.
  46. HBV Inhibitor

    Adefovir is an adenosine monophosphate analog that targets HBV DNA polymerase, exerting its inhibitory effects through conversion to Adefovir diphosphate within cells. Demonstrating an IC50 of 0.7 μM against Hepatitis B Virus (HBV) in the HepG2.2.15 cell line, Adefovir exhibits strong antiviral properties against HBV and other herpesviruses. It is a valuable reagent for research into antiviral therapies and HBV-related studies.
  47. Anti-HBV Agent

    Bepirovirsen is an antisense oligonucleotide specifically designed to target all hepatitis B virus (HBV) messenger RNAs. This compound effectively reduces levels of HBV-derived RNAs, HBV DNA, and associated viral proteins. Bepirovirsen is utilized in research focused on chronic HBV infection, offering insights into potential therapeutic strategies against this viral disease.
  48. HBV CAM

    NVR 3-778 is an oral bioavailable capsid assembly modulator (CAM) targeting hepatitis B virus (HBV). As a member of the sulfamoylbenzamide (SBA) class, it exhibits significant anti-HBV activity. This compound is suitable for research applications focused on investigating HBV replication and the mechanisms of viral assembly, thereby contributing to the development of therapeutic strategies against HBV infection.
  49. HIV/HBV Inhibitor

    Emtricitabine triphosphate tetrasodium salt is the tetrasodium salt form of Emtricitabine triphosphate, a phosphorylated metabolite of Emtricitabine. This compound functions as a nucleoside reverse transcriptase inhibitor, effectively targeting both HIV and HBV. Emtricitabine triphosphate tetrasodium salt is utilized in research applications focused on antiviral drug development and the mechanisms of viral replication.
  50. HBV Inhibitor

    Vebicorvir is a first-generation inhibitor targeting the hepatitis B virus (HBV) core protein. It effectively suppresses the formation of covalently closed circular DNA (cccDNA) in various de novo infection models, demonstrating effective inhibition with EC50 values ranging from 1.84 μM to 7.3 μM. This compound is valuable for research applications focused on developing therapeutic strategies against HBV infections.

Items 1-50 of 140

Page
per page
Set Descending Direction