-
Antiviral Agent
γ-Carboline is a bioactive compound primarily functioning as an antiviral agent. It exhibits significant antiviral activity against Bovine Viral Diarrhea Virus (BVDV) with an EC50 of 2.0 μM. Additionally, derivatives of γ-Carboline have demonstrated antibacterial, antifungal, and antitumor properties, making it a valuable tool for various research applications in virology and broader therapeutic studies. -
NS2B-NS3 Protease Inhibitor
NS2B/NS3-IN-3 is a potent inhibitor of the Flavivirus NS2B-NS3 protease, which plays a critical role in viral polyprotein processing. This compound demonstrates significant antiviral activity, making it a valuable tool for research investigating Flavivirus infections and potential therapeutic strategies. Applications include studies on protease inhibition mechanisms and the development of antiviral drugs targeting flavivirus-related diseases. -
Psoralen Derivative, Viral Inactivator
Aminomethyltrioxsalen hydrochloride is a psoralen derivative that acts as a viral inactivator through nucleic acid intercalation. It effectively penetrates intact cells, allowing it to react with nucleic acid secondary structures in vivo while preserving the integrity of natural nucleoprotein tissues. Upon exposure to UV-A radiation, it crosslinks pyrimidine residues in viral nucleic acids, leading to inactivation of viruses. This reagent is valuable for research applications related to viral infections, including studies on dengue virus. -
Flavivirus NS2B-NS3 Inhibitor
NS2B/NS3-IN-3 hydrochloride is a potent inhibitor of the Flavivirus NS2B-NS3 protease, crucial for the viral replication cycle. This compound selectively disrupts the protease activity, demonstrating significant antiviral efficacy. It serves as a valuable tool for research applications focused on understanding Flavivirus pathogenesis and developing new antiviral therapies. -
DENV Inhibitor
(-)-JNJ-A07 is a potent and selective inhibitor of Dengue Virus (DENV) with an EC50 value of 31 nM. It demonstrates significant antiviral activity, making it a valuable tool for research in virology and the study of DENV pathogenesis. This compound is suitable for investigations into potential therapeutic strategies for dengue fever and other flavivirus-related diseases. -
Yellow Fever Virus Inhibitor
RCB16007 is a selective inhibitor of the Yellow Fever Virus (YFV). It demonstrates effective antiviral activity against the West Nile virus, with an EC50 value of 7.9 μM and a CC50 of 17 μM. This compound serves as a valuable tool for studies related to flavivirus infections and can aid in the development of therapeutics targeting RNA viruses. -
IMPDH Inhibitor
Mycophenolic acid-13C17 is a stable isotope-labeled form of Mycophenolic acid, acting as a potent uncompetitive inhibitor of inosine monophosphate dehydrogenase (IMPDH) with an EC50 of 0.24 μM. This compound exhibits significant antiviral activity against a variety of RNA viruses, including influenza, and serves as an immunosuppressive agent. Additionally, Mycophenolic acid-13C17 demonstrates antiangiogenic and antitumor properties, making it valuable for research in immunology, virology, and cancer biology. -
δ-Opioid Receptor Antagonist/DENV Inhibitor
SDM25N hydrochloride is a potent δ-opioid receptor antagonist that also serves as an effective inhibitor of the dengue virus (DENV). It specifically targets the viral NS4B protein, significantly limiting genomic RNA replication. This compound presents valuable opportunities for research on antiviral strategies and the role of δ-opioid receptors in viral pathogenesis. -
NS5 RdRp/NS2B-NS3pro Inhibitor
LabMol-301 is a potent inhibitor of both NS5 RNA-dependent RNA polymerase (RdRp) and NS2B-NS3 protease, with IC50 values of 0.8 μM and 7.4 μM, respectively. This reagent demonstrates cytoprotective properties by effectively preventing cell death induced by the Zika virus (ZIKV). LabMol-301 is valuable for research applications focusing on antiviral drug development and the mechanistic study of flavivirus pathogenesis. -
Anti-virus Agent
XA-E is a purified compound derived from a methanol-ethyl acetate extract of A. keiskei, targeting viral replication. This compound exhibits potent anti-Zika virus activity, with an IC50 value of 22.0 µM. XA-E is suitable for research applications focusing on antiviral drug development and the mechanistic study of flavivirus infections. -
STT3A-mediated Mega Protein Complex Assembly Inhibitor
NSC-323241 is an STT3A-mediated mega protein complex assembly inhibitor that effectively disrupts the endoplasmic reticulum (ER) mega complex essential for dengue virus (DENV) and Zika virus (ZIKV) infection. By targeting the interaction between the STT3A subcomplex, viral nonstructural proteins (e.g., NS2B, NS3), and host translocon proteins, NSC-323241 impedes the establishment of the viral replication microenvironment. This compound is valuable for investigating the mechanisms of flavivirus infections, including dengue fever and Zika virus. -
Flavivirus inhibitor
Flaviviruses-IN-1 is a potent inhibitor of various viruses within the Flaviviridae family, acting primarily by modulating the host cell immune response to viral infection. This compound has demonstrated significant efficacy in preventing viral replication and infection, making it a valuable tool in virology research. Flaviviruses-IN-1 was identified through high-throughput screening as a promising candidate for therapeutic development against flavivirus infections, offering new avenues for intervention in related diseases. -
Flaviviru Inhibitor
TYT-1 is a sulfonamide-thiourea compound that targets flavivirus replication. It demonstrates potent inhibitory activity against West Nile virus, with a 50% effective concentration of 0.7 µM, effectively blocking a post-entry, pre-assembly step in the viral life cycle. This compound is valuable for research applications focused on understanding flavivirus pathogenesis and developing antiviral strategies. -
Rna Virus Inhibitor
Galidesivir dihydrochloride is a broad-spectrum RNA virus inhibitor targeting various RNA viruses, including Ebola and yellow fever viruses. This compound exhibits potent antiviral activity against tick-borne encephalitis virus (TBEV) and inhibits the proliferation of several other medically significant flaviviruses. Its efficacy makes Galidesivir a valuable tool for research applications focused on viral pathogenesis and antiviral drug development. -
ZIKV NS2B-NS3 Protease Inhibitor
IRBM-Z-1 is a non-competitive inhibitor targeting the Zika virus (ZIKV) NS2B-NS3 protease, demonstrating an IC50 of 1.8 μM. This compound also effectively inhibits the NS2B-NS3 proteases of T156I-mutated dengue virus 2 (DENV2) and West Nile virus (WNV), with IC50 values of 3.9 μM and 4.7 μM, respectively. IRBM-Z-1 is capable of inhibiting ZIKV replication and reducing virus-induced cytopathic effects, making it a valuable tool for research focused on ZIKV infection and associated viral pathogenesis. -
ZIKV NS2B-NS3 Protease Inhibitor
IRBM-Z-2 is an orally active, non-competitive inhibitor targeting the Zika virus (ZIKV) NS2B-NS3 protease, demonstrating IC50 values of 0.04 μM for the wild-type and 3.1 μM for the I156T mutant strains. This compound exhibits broad-spectrum activity against flaviviruses, with IC50 values of 2.1 μM and 0.09 μM against the NS2B-NS3 proteases of dengue virus serotype 2 (DENV2) and West Nile virus (WNV), respectively. IRBM-Z-2 effectively inhibits ZIKV replication and mitigates virus-induced cytopathic effects, making it a valuable tool for research on ZIKV infection and the study of flavivirus-related diseases. -
Anti-HBV Agent
Bepirovirsen sodium is an antisense oligonucleotide designed to specifically target and inhibit all HBV messenger RNAs. This compound effectively reduces HBV-derived RNAs, viral DNA, and associated proteins, making it a valuable tool in the research of chronic HBV infection. The binding site sequence for Bepirovirsen sodium is GCACTTCGCTTCACCTCTGC, underscoring its specificity and utility in virology studies. -
HBV Inhibitor
Adefovir is an adenosine monophosphate analog that targets HBV DNA polymerase, exerting its inhibitory effects through conversion to Adefovir diphosphate within cells. Demonstrating an IC50 of 0.7 μM against Hepatitis B Virus (HBV) in the HepG2.2.15 cell line, Adefovir exhibits strong antiviral properties against HBV and other herpesviruses. It is a valuable reagent for research into antiviral therapies and HBV-related studies. -
Nucleoside Reverse Transcriptase Inhibitor
Azvudine is a potent nucleoside reverse transcriptase inhibitor (NRTI) with notable antiviral activity against HIV, HBV, and HCV. It exhibits strong inhibition of HIV-1 and HIV-2, with EC50 values ranging from 0.018 to 6.92 nM, and effectively targets NRTI-resistant strains. Additionally, Azvudine serves as a click chemistry reagent, featuring an azide group that enables copper-catalyzed azide-alkyne cycloaddition (CuAAc) and strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with alkyne-containing molecules or those with DBCO or BCN groups, making it suitable for advanced chemical biology applications. -
Anti-HBV Agent
Bepirovirsen is an antisense oligonucleotide specifically designed to target all hepatitis B virus (HBV) messenger RNAs. This compound effectively reduces levels of HBV-derived RNAs, HBV DNA, and associated viral proteins. Bepirovirsen is utilized in research focused on chronic HBV infection, offering insights into potential therapeutic strategies against this viral disease. -
HBV CAM
NVR 3-778 is an oral bioavailable capsid assembly modulator (CAM) targeting hepatitis B virus (HBV). As a member of the sulfamoylbenzamide (SBA) class, it exhibits significant anti-HBV activity. This compound is suitable for research applications focused on investigating HBV replication and the mechanisms of viral assembly, thereby contributing to the development of therapeutic strategies against HBV infection. -
HIV/HBV Inhibitor
Emtricitabine triphosphate tetrasodium salt is the tetrasodium salt form of Emtricitabine triphosphate, a phosphorylated metabolite of Emtricitabine. This compound functions as a nucleoside reverse transcriptase inhibitor, effectively targeting both HIV and HBV. Emtricitabine triphosphate tetrasodium salt is utilized in research applications focused on antiviral drug development and the mechanisms of viral replication. -
HBV Inhibitor
Vebicorvir is a first-generation inhibitor targeting the hepatitis B virus (HBV) core protein. It effectively suppresses the formation of covalently closed circular DNA (cccDNA) in various de novo infection models, demonstrating effective inhibition with EC50 values ranging from 1.84 μM to 7.3 μM. This compound is valuable for research applications focused on developing therapeutic strategies against HBV infections. -
HIV Inhibitor
(S)-Tenofovir is an S-enantiomer of Tenofovir, functioning primarily as a nucleotide reverse transcriptase inhibitor. This compound demonstrates significant biological activity against HIV and is also relevant in the treatment of chronic Hepatitis B (HBV). It is commonly utilized in research applications focused on antiviral therapies and the mechanistic study of retroviral infections. -
HBV Inhibitor
Inarigivir ammonium is a potent HBV inhibitor that functions as a RIG-I (Retinoic acid-inducible gene-I) agonist, stimulating the innate immune response to combat hepatitis B virus infection. This compound has demonstrated effectiveness in significantly reducing liver HBV DNA levels in transgenic mouse models. Due to its mechanism of action, Inarigivir ammonium is positioned as a valuable tool for research in antiviral therapies and the study of hepatitis B virus dynamics. -
Anti-HBV Agent
Chamaechromone is a biflavonoid compound derived from the roots of Stellera chamaejasme L. It exhibits potent anti-hepatitis B virus (HBV) activity by inhibiting the secretion of hepatitis B surface antigen (HBsAg). This compound is valuable for research in virology, particularly in the study of HBV infection and potential therapeutic interventions. Additionally, Chamaechromone displays insecticidal properties, indicating its multifaceted biological activities. -
HBV Inhibitor
5-O-(E)-p-Coumaroylquinic acid is a quinic acid derivative that serves as a potent inhibitor of hepatitis B virus (HBV). This compound exhibits significant antiviral activity, making it a valuable tool for research into HBV pathogenesis and therapeutic strategies. Its unique structural properties may provide insights into the development of novel antiviral agents targeting viral replication. -
HBV Inhibitor
Schisantherin C is a potent inhibitor of hepatitis B virus (HBV) with demonstrated efficacy in reducing hepatocyte secretions of HBsAg and HBeAg by 59.7% and 34.7%, respectively, at a concentration of 50 μg/mL. This compound holds potential for research applications aimed at understanding HBV pathogenesis and developing effective antiviral therapies. -
HBV Inhibitor
ALG-001075 functions as a capsid assembly modulator (CAM) and serves as an orally active inhibitor of hepatitis B virus (HBV). This compound effectively inhibits HBV DNA production, along with extracellular HBsAg/HBeAg and intracellular HBV RNA in primary human hepatocytes. In the AAV-HBV mouse model, ALG-001075 demonstrates significant reductions in circulating HBV DNA. It is valuable for research applications focused on chronic hepatitis B (CHB). -
HBV Inhibitor
SAG-524 is a highly effective small molecule inhibitor targeting hepatitis B virus (HBV) replication. It demonstrates significant antiviral activity, reducing HBV-DNA and HBsAg levels in supernatants of HepG2.2.15 cells, with IC50 values of 0.92 nM and 1.4 nM, respectively. SAG-524 is valuable for research focused on HBV biology and therapeutic development for liver diseases associated with viral infections. -
HBV Capsid Inhibitor
AB-836 is an orally active inhibitor of the hepatitis B virus (HBV) capsid, targeting the HBV core protein to impede viral replication. This compound is valuable for research focused on chronic hepatitis B, offering insights into antiviral strategies and mechanisms of HBV pathogenesis. Researchers can utilize AB-836 to explore its potential therapeutic applications in HBV-related studies. -
HBV Inhibitor
Xalnesiran sodium is a small interfering RNA (siRNA) designed to inhibit hepatitis B virus (HBV) replication. It provides a valuable tool for researching chronic HBV infections and understanding the virus's biology. This compound is particularly relevant in studies aimed at developing therapeutic strategies for managing HBV-related diseases. -
HBV Inhibitor
CCC-0975 is a selective inhibitor of the hepatitis B virus (HBV), demonstrating an EC50 of 10 μM. This compound effectively disrupts the conversion of relaxed circular DNA (rcDNA) to covalently closed circular DNA (cccDNA), leading to a reduction in both cccDNA and its precursor, deproteinized rcDNA (DP-rcDNA), without inducing their degradation within the cell. CCC-0975 is a valuable tool for research focused on chronic hepatitis B and its associated mechanisms. -
Anti-HBV Inhibitor
IR415 is a potent inhibitor of hepatitis B virus (HBV) replication, primarily functioning by blocking the activity of the HBx protein. It exhibits a high affinity for HBx with a dissociation constant (Kd) of 2 nM, effectively disrupting HBV-mediated RNA interference suppression. By reversing the inhibitory effects of HBx on the dicer endoribonuclease, IR415 serves as a valuable reagent for research into antiviral strategies and mechanisms of HBV pathology. -
Antiviral Agent
Helioxanthin is an antiviral agent with demonstrated in vitro activity, exhibiting an effective concentration (EC50) of 1 μM against hepatitis B virus (HBV). Additionally, Helioxanthin shows efficacy against flaviviruses, making it a valuable compound in antiviral research. It is suitable for studies focusing on the development of treatments for viral infections. -
HBV Inhibitor
Torcitabine, also known as 2'-Deoxy-L-cytidine, is an antiviral compound targeting hepatitis B virus (HBV) replication. It demonstrates significant inhibitory activity against HBV, making it a valuable agent in the research and development of treatments for chronic HBV infections. Its mechanism of action involves incorporation into viral DNA, effectively disrupting viral replication and propagation. -
Reverse Transcriptase Inhibitor
FNC-TP is the intracellular active form of the nucleoside reverse transcriptase inhibitor (NRTI) FNC, targeting reverse transcriptase enzymes. This compound exhibits potent antiviral activity against HIV, HBV, and HCV. Additionally, FNC-TP serves as a versatile click chemistry reagent, featuring an azide group that participates in copper-catalyzed azide-alkyne cycloaddition (CuAAc) and strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with alkyne, DBCO, or BCN-containing molecules, facilitating advanced research applications in chemical biology. -
Anti-HBV Agent
Alamifovir is a purine nucleotide analogue proagent that targets hepatitis B virus (HBV) with potent antiviral activity. It demonstrates efficacy against both wild type and lamivudine-resistant strains of HBV, effectively inhibiting viral replication. Alamifovir is employed in research applications focused on the treatment and management of HBV infections. -
HBV Inhibitor
CYP1A1 inhibitor 8a is a selective inhibitor of the CYP1A1 enzyme, showing over 10-fold selectivity for its target and greater than 100-fold selectivity against other CYP1 subfamily enzymes. This compound effectively antagonizes benzo[a]pyrene (B[a]P)-mediated activation of the aryl hydrocarbon receptor (AhR) in yeast models and demonstrates protective effects against CYP1A1-mediated B[a]P cytotoxicity in human cells. Due to its significant inhibitory properties, CYP1A1 inhibitor 8a holds promise as a potential agent for cancer chemoprevention. -
HBV Inhibitor
Neochlorogenic acid methyl ester is an HBV inhibitor that functions as a selective inducer of quinone reductase (EC50 = 6.7 μM) while demonstrating potent hydroxyl radical scavenging activity (EC50 = 0.81 μM). This compound plays a critical role in antioxidant defense by donating electrons or hydrogen atoms to neutralize hydroxyl radicals, thereby promoting carcinogen detoxification. Neochlorogenic acid methyl ester is utilized in research investigating antioxidant damage and metabolic detoxification, particularly within the contexts of cancer chemotherapy and diseases related to oxidative stress. This compound is derived from the flower buds of *L. japonica*. -
Anti-HBV Compound
Isothiafludine is an orally active non-nucleosidic compound that targets hepatitis B virus (HBV) replication. It functions by inhibiting the encapsidation of pregenomic RNA, thereby effectively reducing viral replication. Isothiafludine is utilized in research focused on HBV and has potential applications in the development of therapeutic strategies against hepatitis B infections. -
HBV Capsid Assembly Modulator
VNRX-9945 is a potent capsid assembly modulator targeting Hepatitis B Virus (HBV) with an EC50 of 2.6 nM. It exhibits broad antiviral activity against multiple HBV genotypes in vitro, demonstrating its effectiveness in diverse biological contexts. Additionally, VNRX-9945 shows favorable pharmacokinetic properties across various species and has demonstrated significant antiviral efficacy in adeno-associated virus mouse models of HBV infection, making it a valuable tool for HBV research and therapeutic development. -
HBV Inhibitor
Tiviciclovir is a guanosine analog that acts as a selective inhibitor of hepatitis B virus (HBV). Its primary mechanism involves interfering with viral replication, making it a valuable tool in the study of HBV-associated diseases. This compound is primarily utilized in research focused on antiviral therapy and the development of treatments for chronic hepatitis B infections. -
HBV Inhibitor
2'-Deoxy-L-adenosine is a potent inhibitor of hepatitis B virus (HBV) replication, targeting the viral polymerase with high specificity and selectivity. This compound functions as a synthon for modified oligodeoxyribonucleotides, making it a valuable tool for research focused on HBV and related hepatotropic viruses, including woodchuck and duck hepatitis viruses. Its ability to interfere with viral replication positions it as a significant reagent in studies aimed at understanding and developing therapies for HBV infections. -
Reverse Transcriptase Inhibitor
Lamivudine triphosphate TEA is a potent reverse transcriptase inhibitor that functions by terminating the elongation of viral nucleic acids. It effectively inhibits the reverse transcriptase of HIV and HBV, thereby obstructing viral replication. Additionally, Lamivudine triphosphate TEA targets the RNA-dependent RNA polymerase (RdRp) of the NS5B subunit in HCV, and can be incorporated into the RNA by the RdRp of SARS-CoV-2, interrupting the synthesis and leading to a decrease in mutations in the viral genome. This makes it a critical reagent for research in antiviral therapies and viral replication studies. -
Anti-HBV Agent
Glycosmisic acid is a natural compound that exhibits anti-hepatitis B virus (HBV) activity. It is employed in research related to viral infections, particularly in studies aimed at understanding and developing therapeutic strategies against HBV. This compound may also serve as a valuable tool for investigating the molecular mechanisms underlying HBV pathogenesis. -
HBV Inhibitor
Besifovir Dipivoxil maleate is a potent HBV inhibitor acting as an oral proagent of LB80317. It demonstrates significant efficacy in suppressing hepatitis B virus (HBV) DNA in both treatment-naive and lamivudine-resistant chronic hepatitis B (CHB) patient populations. This compound is valuable for research into therapeutic strategies for managing chronic hepatitis B infections. -
HBV Capsid Assembly Modulator
SHR5133 is a potent HBV capsid assembly modulator that functions through the inhibition of hepatitis B virus (HBV) capsid assembly. Demonstrating an EC50 of 26.6 nM, SHR5133 effectively reduces HBV DNA levels. This compound is primarily utilized in research applications focused on HBV infection and therapeutic development. -
Anti-HBV Agent
Firzacorvir is a cyclic sulfamide compound that targets and modulates the hepatitis B virus (HBV) core protein. It exhibits significant anti-HBV activity with an EC50 of less than 1 μM. This reagent is essential for research applications focused on the treatment and management of HBV infections. -
Reverse Transcriptase Inhibitor
Lamivudine salicylate is a nucleoside reverse transcriptase inhibitor (NRTI) with potent activity against HIV reverse transcriptase 1/2 and hepatitis B virus reverse transcriptase. Its oral bioavailability and ability to penetrate the central nervous system make it a valuable compound for anti-viral research. Lamivudine salicylate is widely utilized in studies focused on the treatment and management of HIV and hepatitis B infections.

